Intro Week-2015/notes

The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

MMDC staff introduce their research - notes

Simon Pummell

Secretive about his practice. A new vocabulary.
It has been more common to talk about a project - talking of film as objects.
I make films.
trailers: advertisement purpose + ..

Body Song
An exercise in using archival footage. Fragments form an operative curve. 3 cutting-rooms running at the same time.
Used a team of researchers working for the film. Ask archivists collaborators of the film, to guide the researchs through the material of the archives

Process:

script - that was a visualization of the film.
abstract - based on the script
3 chapter for a CDROM
recruited researchers whom were given the screen-play
researchers: were asked to gather based on the script, plus all the material they found along
growth, violence, dancing, ritual, etc (50 topics)
then: process of selecting, cutting, editing

started looking for tinny dramatic moments in each clip featuring a certain arc, and a moment of disruption
Looked for a macro narrative arch, but also dramatic micro moments in each clip.

Steve: "Narrativising knowledge".

motivation to start such process was a quote by William Gibson: "we invented mirror that remember, and we don't understand yet what to do with them"
film of your life became the shape of the project

Steve: point of overlap in our work is, how do you represent that there is a system that is creating knowledge?

Schock Head Soul

A hybrid between documentary and drama.
Based on a book by Daniel Paul Schreber. https://en.wikipedia.org/wiki/Daniel_Paul_Schreber A total parallel version of the universe. The cosmos was giant writing machine.
Schreber was one the most successful German lawyers and ended-up being trown to the margins of society by his illness
His father was a famous phychiatrist, that believed that kids should be under total control. He designed machines for this. This function has been physicalized through these machines.
Simon started the project by direction a short on Schreber s father. However that was not financial. So the question was how can a film be made on a dark and unappealing topic as this one. What allowed the financing of the film was the perspective of Schreber as writer (as he was not remembered as being mentally ill). The film portraits the ways the machines visit Schreber.
The main machine in the film is a globe-shaped typewriting machine, that used to be one of the first typewriters, designed for blind people to write.

Steve: relation between writing and writing machines. this relates to the writings of Kittler - Gramophone, Film, Typewriter. As we are getting this new forms of data collections (eg. a grammaphone to record sound), these are new forms of memory collections. This puts in crisis on the monopoly that writing had a medium for memory.

Sputnik Effect
3D installation in Rotterdam, as a companion peace to Shockhead Soul
related to the ancieties at that time (when was it made?)
Steve: forms of subjectivity, often meets the technical standards of the day
more often, Simon worked with making films and making installations/webpages/cd-roms at the same time

Steve: He uses writing and the discourse of the court - where you the written form. He becomes part of that machine that writes him.

There is a panel of psychiatrists that adviced on the script and are also present on the films (as the jury of the court). They speak about differences between psychiatery of the 21st & 19th century.

Fimls look for ways to bring research into film, outside the usual venues of research.

Next to this film, there was a webpage where all the interviews with the panel of psychiatrists where published in a raw state, against the greenscreen.

Brand New-U
http://pummell.com/?C=15&A=57
http://brandnew-u.com/
new film, that is released at the moment
science fiction film
less explicitly research driven than the other two films
bridging an experimental approach to film making, and making a more popular film

---

preference at the moment to make bigger films, which give you time, the making process is slower

science fiction film based on a short story by William Gibson

making films is a creative process to make something that is out of your control in a way, something that is bigger than you are as a maker.

Reference:
Peter Watkins Edvard Munch (1974) http://www.imdb.com/title/tt0074462/ - uses the same devices with the experts that Simon uses in Shock Head Soul

Reanactment:
Peter Watkins La Commune (2000) https://en.wikipedia.org/wiki/La_Commune_%28Paris,_1871%29

On Not Being Able to Paint -- Joanna Field

http://www.pummell.com

( Canada Winnipeg see film My Winnipeg (2007) Guy Maddin)

--------------

Aymeric Mansoux

(http://bleu255.com/)

The bigger picture of Aymeric research - does not have it - as documentation is scattered over many HDs.
Jealouse of people that have a vertical practice, who can stay only on one area, as his research is all over the place.

>>> mkslide "thomson mo5" slide.png && feh -Z -F slide.?
(mkslide is a custom script then? an image magic combine?) combined with search results?

• thomson mo5 computer
first machine at home, learned programming at an age of ±12 years old
wikipage --> https://en.wikipedia.org/wiki/Thomson_MO5
Thomson mo5 was working with k7 tapes It was a way to understant how digital information happened

>>> feh 010-atari.png
(feh? — http://feh.finalrewind.org/)

• atari ST
wikipage --> https://en.wikipedia.org/wiki/Atari_ST
pixel art and programming demos. Making bitmap font. It was the first time that was proto-network with an online community to share files around. Every Demo has a team of programmer, artist, musician. A new culture of like minded people. Making a project from a to z and distribute it through the network.

Demo Scene > https://en.wikipedia.org/wiki/Demoscene

>>> feh 030-blue.jpg

As grahics was quite his thing Aymeric got into dot.com boom as web designer and programmer (19 years old— which means pre Google, Altavista era.)
area of polygons, 3D-ish, time of flash, layers
> Warp music, IDM

BA in Economics - traumatizing times, but switched to Fine Art
a place where he expected to have critical look at technology. But it keeped being a kind of hobby next to the company.
> Huge disappointment
Instead start working in sculpture and discovered video-art and post-production (After Effects)

>>> mpv 040-stmsql.avi

Aymeric created software to video-edit a proto markov chain did he say? (yes) :-)
the programm was creating a story board, picking video's from a database

>>> mkslide "game of life conway" slide.png && feh -Z -F slide.?

https://en.wikipedia.org/wiki/Conway's_Game_of_Life

3D celular automata played Kurt Schvitters Ursonate
used as a composition tool for the video's

but, still more fun in the company, then in art school, more freedom

Master > Stopped video started to focus on real time experiments
Looking for ways to speed up the prototyong brough him to discover Pure Data (PD) (developped in the late 90s)

>>> mkslide "pure data pd" slide.png && feh -Z -F slide.?

PD, software mostly produced to use with audio, but also possible to work with 3D objects
an open-gl extension was being developed - GEM - for 3D graphic
similarity to analog synsthesizers
the result of that was speed

How could use the network as a artistic material?

>>> mpv 050-stmql....mp4

graduation work for BA?(or master?) MFA was mentionned, not sure what that means, master fine art?

>>> tracerout google.nl
$ traceroute google.nl
traceroute to google.nl (74.125.136.94), 30 hops max, 60 byte packets
1 145.24.255.254 (145.24.255.254) 2.803 ms 2.769 ms 2.747 ms
2 eth-1-17.mu-mu.mu-nx7010-2.hro.nl (145.24.8.134) 3.490 ms 3.484 ms 3.468 ms
3 Intern-Zone-VIP-PAN.hro.nl (145.24.8.121) 120.892 ms 121.105 ms 121.920 ms
4 vlan602-mu-nx7010-1-internet.hro.nl (145.24.8.114) 123.199 ms 123.385 ms 123.387 ms
5 XE4-1-2.2122.JNR01.Asd002A.surf.net (145.145.24.13) 134.609 ms 134.818 ms 134.817 ms
6 google-router2.customer.surf.net (145.145.166.86) 128.684 ms 6.352 ms 6.623 ms
7 209.85.143.167 (209.85.143.167) 6.791 ms 7.346 ms 7.555 ms
8 209.85.253.249 (209.85.253.249) 8.465 ms 72.14.238.153 (72.14.238.153) 8.728 ms 209.85.240.138 (209.85.240.138) 9.076 ms
9 209.85.255.75 (209.85.255.75) 12.475 ms 216.239.48.104 (216.239.48.104) 12.948 ms 74.125.37.117 (74.125.37.117) 13.212 ms
10 216.239.49.38 (216.239.49.38) 12.925 ms 209.85.243.175 (209.85.243.175) 14.012 ms 209.85.243.241 (209.85.243.241) 14.009 ms
11 * * *
12 ea-in-f94.1e100.net (74.125.136.94) 9.664 ms 10.715 ms 10.615 ms

traceroute maps all the routes that the network traffic travels between my machine and the machine i am calling.
The positions of the cubes are relative to the IP of the users. The IPs are generating the sound, colour, position

>>> mpv 051-stmql3 ... .mp4
>>> mpv 052-stmql ... .mp4

microsoft server traceroute: dark, dark green, low tones

A choice was now ahead: futher the path of network art or revert to the webdesign jobs.
Aymeric was nudged away from webev, as the .com crash was happening as he was graduating. The industry was packing up shop and preparing for the 'next big thing' which was mobile development.
But his MFA graduate work was shown in Paris, had good feedback and discovered media art /scene/
Education for/as procrastination.

>>> mpv 070-placard-bbq-headphone-5.mov

Placard Performance/Festival - http://leplacard.org/
with boradband to stream sound from one home to home. since there were many venues in Paris, there began a scene of noise performance with headphones. The performance could be streamed to the neighbors, as not many people could listen to
Aymeric joined and the project grew quite wide. Placard double meaning: as a cupboard, but also as the act of 'placarding' / 'displaying'

https://c1.staticflickr.com/1/119/271211287_2e9fe7b728_z.jpg?zz=1

When he left the Placard, he started a collective called goto10 , drawing on the previous project
http://goto10.org/
Distributing and building free-software. mid Naughties.
running 20-25 VPS, to serve other artists and projects to have server space

• Make Art Festival - a festival about what "people like were doing". there were no room for people like GOTO10 who were not making a distinction betwen artist and technician.
http://goto10.org/make-art-festival/
http://makeart.goto10.org/main/

• Puredyne Linux distribution for artists
was a business model, giving workshops at universities, to teach and give lectures
the need to be more efficient on this workshops: How do you teach free software in a place where there are only mac's and window's machines? --> As part of the workshops, there was a 3-day preperation to install free software on the machines.
As to accelerate this process they made there own distribution - live CD/USB.
It became higly popular, with quite some funding from The Arts Council.
It was also the groups distribution, they were all running Puredyne.
https://en.wikipedia.org/wiki/Puredyne

FLOSS + Art book (it's upstair in the shelve and in the hall, no?)

It reflected the diversity of the views on the scene:
Common themes: the need to reform copyright

and the pdf is on monoskop
http://monoskop.org/images/a/ad/Mansoux_Aymeric_de_Valk_Marloes_eds_FLOSS_Art.pdf

61EnTISxiYL._SX331_BO1,204,203,200_.jpg

>>> mpv 090-4NX.avi

back to noise performance
feedback loops

>>> mpv 100-xxxxx.ogg

>>> mpv 110-sheepsinit.ogg

catkit?

Constrain inherit to GOTO10: we music and art but we also make the tools to make music and make art.

2007/2008artificial life interest, most people who are into programming are becoming interested in it

>>> mpv metabiosis...

inspire ideas of what is happening inside the computer
life-like properties
take a randomly moving dot on a screen, and people start to interpret that it is nervous
all questions are about how you imagine your creature to be?
answers to the questions turn into behavior of the creatures.
children designed their own virtual plant, and let it grow, by carefully picking a number range
we wanted to remove the metaphors, to be at close between hardware and software
hello process shows a machine doing what it does best, copying and removing data
with metabioses, we wanted to engage an audience with abstract processes

http://metabiosis.kuri.mu/

after a time at goto10, there were tools developed, that were used in metabiosis, and for other projects by the other goto10-ers.

PZI
a lot of goto10 elements came back in the PZ
for example the wiki of the PZ

it became more difficult to do short projects (two little kids change a lot)

Naked on Pluto
http://pluto.kuri.mu/
first work outside goto10 --> a game, app, working with Facebook
long process on beforehand, before actually writing any line of code

in the end became a installation in the form of a library,
where the process of the game was logged ....
where people could pick up books, browse the books,
there was a bot...

PHD at Goldsmith, in Cultural Studies
in the last 6 years A is trying to finish this by December!

about free software culture
the useful critic from this scene
it's a shift that comes from a hacker culture in the 60s in the US

then, 90s
semantic wars between different languages
radical democracy, a model mostly developped by ...
conflicts are useful, in opposite of an aim for democracy based on agreements

« Art libre »

One of the chapters of the PHD tries to look beyond movements having a typical 'hero' that can be a symbol to explain said mouvement, lit it was done in the field of post-cultures, like punk ...
model of society, that moves beyond the systems of control & discipine to a system of sandbox. If it is something that is conscious is can reach true plurality.
today: constant emulation of consious ...

Skor Codex
It's a book! a critic on the archive
http://societeanonyme.la/
PDF of book > http://societeanonyme.la/media/the-skor-codex-web.pdf

Lurk - http://lurk.org/
platform, that tries to go out of Facebook, etc.
(we're going to try and use something like this at PZI, right?)definitially! / definitely (excellent word, mb!) ;)
all content dissapears in social network. There is no mean to preserve it. Lurk is a way to attract people to engage in disscussion of media art and software art practices, outside facebook.
small community, but enough people to keep discussions going on

In the future: Favicon game considered
Media Archology ?

QUESTIONS:

early netwrok that were using to coordinate and share demos was bulletin boards? (long but OK documentary about BBS https://www.youtube.com/watch?v=JnSz-Hb9LQY )
what is the mkslide programm?

Media Art Instituite NL http://nimk.nl/eng/

--------------

André Castro

publishing, electronic publishing
presentation is at the wiki: http://pzwiki.wdka.nl/mediadesign/User:Castrobot/research-20150914
Working at WdKA

• Narratives of Inception > Grad project from PZI
419 Spam email
Spam emails build , Skeam on giving money..
Stories, diffrent types.. around 5 types

Help person, afganista, african politcion
same basis, structurely and contentwise

This was the start of making a database of these spam-emails
which ended up in the form of a performance

http://pinknoi.so/2013-Works-NarrativesofDeception.html

networked texts, and publications

• epub

in the end a website, and so more stable then interactive platforms
in Calibre, there is an 'edit book' button
'an off-line website'
being able to copy and own your book

book trailers:
python script developed at the Digital Publishing Toolkit at the INC, by Michael and Silvio Lorusso
http://networkcultures.org/digitalpublishing/2014/10/13/epub-trailers/
https://github.com/DigitalPublishingToolkit/epubtrailer.py/blob/master/epubtrailer.py

trailer-Flatland_A_Romance_of_Many_Dimensions_Illustrated.gif

"The book of the future will not simply imitate the forms of a codex migrated onto new platforms … It will arise from an analysis of the functions of each element of design for the purpose of navigation, orientation, representation, reference and commentary and then rethink the ways the capacities of networked electronic environments can extent these functionalities and encode them in a innovative approach to design".
Johanna Drucker, Graphesis: Visual Forms of Knowledge Production

Epub Backup & Amazon control debacle
http://p-dpa.net/work/e-book-backup/

• examples of ownership of ebooks:

MIT publishers, forces its users to use Adobe ID

Verso, publisher embedded a buyers email address in every chapter, which makes it difficult to share the bought books

• Bibliotecha:

http://bibliotecha.info

offline network for book swapping

raspberry pi + wifi dongle + linux distribution
open wifi signal, which redirects any page to Bibliotecha
only works in the reach of the wifi dongle — offline!
(there is a mailinglist running inside Lurk, subscribe here: http://lurk.org/groups/bibliotecha/)

coming up: collaboration with a collective from Utrecht, called read in
there is a performance? coming up on the 21st September, de Punt Amsterdam (http://depunt.org/)
http://read-in.info

• epubs @ the INC
http://networkcultures.org/digitalpublishing/
https://github.com/DigitalPublishingToolkit

0419-HVA_DPT_from_print_to_ebooks_OS_epub_p-211x300.png

• Beyond Social

another workflow, online publication + paper
proposal: to work with the wiki as a writing platform

http://beyond-social.org/articles/Making_Beyond_Social.html
http://beyond-social.org/wiki/index.php/Main_Page

a wiki starts pretty flat: no strict structure, only user-pages and 'normal' pages
+ workflow to work collaboratively

different categories:

- proof me
- edit me
- publish me

then .. wiki API to make an interface for the wiki-backend

• Refugee Phrasebook

https://en.wikibooks.org/wiki/Refugee_Phrasebook

Steve:

balance between an uniform platform and the epub that is flexible to take along, change, edit

---

Pannel discussion:

Everything seems quite templated?
moment of swiping from the 90s to the 2000s

screen culture about disappearing in a screen, and about imagination?
if it can't be looked at a phone, there is less interest. So focus is on platforms and functionality.
Simon connects the webplatform from his 'Body [works?] ' with Aymeric's work with the PD patches that traceroutes a user's connection. Today the only concern seems to be about mobile. Back then web devs were quite exited about considering websites as platfoms.

AM: The focus on interfaces, market promoted mobile functioning, ... it narrows down the possibilities you have as a designer

SP: There seem to be an emphasis now at a certain sustained attention, not-being-distracted. Where a decade ago the emphasis would be much more at an experimental scene.

SP: the universal library, the act of being interconnected .... What would it be to rewrite a book?

SR: Reading as a technology: The alphabet is a marvulous piece of software.

AC: Another reason to not go to the cinema, is that the films i want to see are not screened in the cinema's. That's why we go back to pirate films.

AC: is it a lack of initiatives to break the circle of the cinematic big boys?

SP: the instability of the position of media-culture between arts and industry

Colm: the cultures industries did not adapt yet how to cope with mechanism of digital distributions.
More interesting media in piracy, than culture insdustries.

AC: on the one hand creative industries, and the other hand Silicon Valley. In between is piracy?

AM: on the one hand there is a main stream culture (Netflix). and on the other hand, there are people defining their identity, specificity by selecting their media. They work in a much smaller scale. These two are not compatible.

Cinema trackers? Smaller scale curation for specific genres, specific nietzsches (nietze's):)? Idk: https://en.wikipedia.org/wiki/Friedrich_Nietzsche right? right. :D

SR: IMdB positions your credits according to the popularity of the actor. It's an algorithmic process.

Karagarga?
Where Can I Get A Karagarga Invite? --> https://answers.yahoo.com/question/index?qid=20080902150305AAHUNCf
http://karagarga.in is up

AM: it can develop into two extremes: very big productions on the one side, and a new form of digital folklore on the other side

------------------------------------------------------------------------------------------------------------------

Barend Onneweer

Demoreal 2006-2008
Tv opening
cheesy music video

visualize alzimers

most work in visual effects, visual trickery '

childphoto

as a kid, drawing more then reading.. or drawing what I am reading
after highschool, traided in art ediucation.
Diploma as art teacher as 22 but no interest in giving classes then

Short films

Both of grandfathers as woodworker and carpenter
always been around people who makes something with their hands

B says that the sensibilty of building and creating was one that came down from his family past. Maybe what pushed him into film.
Noting a rift between the relative ease of drawing production vs film production.

When he graduated from film 1998 the methodologies were quite complex and cumbersome. Editing is complex and equipment relative.
Celluloid editing still when B graduated. Slight shift towards digital then, but nothing really significant yet.
Key word: Tinkering.

Digital sort of was more suited to this tinkering, even though the machinery was more like stocking fridges than anythin else.
The necessary machines meant that you had to book different rooms & equipment to work. B explains that he misses the ability (from his past as a painter) to just go to a space and work whenever (at 5AM for example) and not having to book a room. Equipment infuenced the way he worked. Not possible to work organically.

The change came with 'Desktop oriented sorfware' PS, AE, single user designed sw.

Photoshop 2 and After Effects . as flexibel as painting

Own studio on the "spare bedroom" but not something like a "iron man project"

was writing and directing own movies. mostly working on other peoples projects. the last 12 years

Being in control. Having ones own hands in the material.
Smaller working scale also directly influenced lower production costs. Which then meant independance, and artisan practices.
Working as a team might envolve company management. And B has control issues. He's repeated this a few times now :)
Mix of commercial and 'cultural' (music videos) up to then but after meeting Simon 5 years ago, shift to [...] something more interesting.

There seems to be a focus, or an appreciation for smaller scale, smaller teams, smaller 'ambitions' ?

Smaller teams also comes back into conversation when speaking about relative aesthetics. Smaller teams signifying less divergeance in potential visual fingerprint.

Brand new-u also a collab with Simon. Different ambitions whith regards to photo realism.

We speak about the abstraction necessary for the actors when working in this way, actors working in almost only greenscreen environments. Comparison to Stage acting, make believe.
It would have been possible to do this shoot, in, say, Tokyo, but the soundstage seems to give more flexibility. Here B designs all types of elements, objets to environments.

The tinkering is still the fascination, but bigger scale productions (star wars for ex) is not interesting. Being one cog in a huge machine seems quite boring. Having a boss is a no no.

Meanwhile B's work is sought out by documentary makes now. Maybe the opposite direction from science & fiction. "Documentary is truth amplified". In that sence, documentary makers use special effects to narrate better, to complete stories with 'light' trickery.
The links back to painting become more aparent when speaking about relations with directors, who focus on the 'bigger picture' (pardon the pun) rather than technical specificities. Effect creation in the film environment has a similar truth to painting on canvas.

'Democratization' thanks to digital production methods.

SR: So how do you work with students?
Focus on the storytelling, not on the tooling.
Example of ex student 'dan' ?
Low cost base = affordable time, and also the flexibility of schedule, and being able to help out a fellow every now and then.

BL: Considering the shift away from physical space necessity for film, what are your oppinions on replacing physical actors?
example of Benedict Cumberbatch playing the dragon in The Hobbit: good example of how in this case, a non human character is then embodied by a human actor.
Hologram of 2pac on stage.
We're still in Uncanny Valley: It's not yet possible to actually digitally substitute a human.
Necessity, desirability, and possibility.
Necess: is it realy necessary
is it desirable,
is it possible?

The fear is a kind of baroquery, of everything in motion.

-----------------------------------------------------------

David Haines

David specifically asked us to shut down laptops during his presentation, which is completely reasonable, so these notes are from memory: PLEASE COMPLETE

projects viewed:
    Boys Next Door
    3 Months
    [...] Honeymonster [...]
    Dereviled
    Dereviled is the word deliverd written backwards DEREVILED = DELIVERED which refereces the types of footage that was used to make up this piece.
    Delivery of homosexuals by church practices.

    Interlaced with some graphite compositions. These are not labeled photo-realism, David makes a clear point of this. ( I can't remember exactly the distinction D made between a description by line (contour?) and a description (a definition?) by light.


-------------------------------------------------------

Michaeaeaeael Murtaugh

"Learning about archiving the hard way"
is the subtitle M gave to his talk

what was the link? battlestar.local ? (yes, but doesn't work for me..) damn.
https://pzwiki.wdka.nl/mediadesign/User:Michael_Murtaugh/Research_2015

studied Computer Science/Electrical Engineering at MIT
MIT media lab

• at MIT --> STS, Science Technology Society programm, with Sherry Turkle
comming from programming ... then different field?
write an essay about an object
Ref: Seymour Papert: Gears --> "Was there an object you met in your childhood......."

6013.TurtleGraphics05b.PNG

• logo --> programming language (designed for graphical description) https://en.wikipedia.org/wiki/Logo_%28programming_language%29
learning through making
example of logo is the virtual turtle
an approach of constructivism, a learning method, as opposed to a cartesian way of learning through understanding
what would it mean to draw a circle with your body?

Michael's object: Easy Bake Oven
in the book Falling for Science: Objects in Mind, Sherry Turkle (1991)

• Tech Model Railroad Club
TMRC and RMS First encounter with R. Stallman. First mention of Free software. At the time disregarded because of the embodyment by and old bearded guy.

• Master programme: interactive cinema (at the Media Lab?)

project: interface for a film archive (1995)
the internet was still very new at this time
interest in archiving started here

at the MIT:
Muriel Cooper, the Visual language workshop - VLW ( http://museum.mit.edu/150/115 )
but Michael was at the Media Lab http://media.mit.edu/ https://en.wikipedia.org/wiki/MIT_Media_Lab:
focus on broadcasting, publishing and computation
(what was it about the military influence?)

The interface of this project was informed by VLW: index of the mixety of the content. We're presented with a buch of colors and icons to parse through the bulk of content, enabling you to 'drill down' into the content. The example uses Jerome B. Weisner.

• Jam New Media:
(2006?) came to the Netherlands, worked at the New Metropolis (now called Nemo)
working on a video-interface for the KWF Cancer organisation
These videos document as best the ways that patients deal with their medical conditions. Micheal was part of the team which made an effort to augment this video data with text descriptions, sub & side titles, and designing the interface that make the 'archive' searchable.
at the moment, these kind of video's would be placed at Youtube, outside their own webpage

• Unravelling (Net)works
Here, There And Other Dislocations (it doesn't work anymore)
video cross-references interface, in flash, and therefor sadly enough not working anymore
finding out this new 'state' of former work: *loading*

• MDMA - Media Design Master
(in one of the kubuswoningen!)
setting up a masters course with Matthew Fuller, Femke Snelting, and Florian Cramer
M Fuller: Software Studies. --> let's think about software beyond the traditional domain
Software can be seen as an object of study and an area of practise for kinds of thinking and areas of work that have not historically "owned" software, or indeed often had much of use to say about it. (first sentence) ;)
Matthew would talk about Vaporware, which sets up the market to desire something. E.g. Apple culture
'interaction' is the entry that Michael wrote in this book (Software Studies)

Matthew current http://www.gold.ac.uk/cultural-studies/staff/m-fuller/
http://monoskop.org/Matthew_Fuller

at that time, there was a residence programm next to the Master
(including an appartment in the neighbour cube!)

the internet seems to be not the imagined ideal technology for archiving (currently it proves to be not)
software breaks.

• Constant

organization, multidisciplinary, Brussels, a huge octopus
constantvzw.org

• Active Archives, http://activearchives.org
http://git.constantvzw.org/?p=aa.core2.git;a=blob;f=README;h=1ca6828217dd5cbd00417db8a61213cecd56dd5a;hb=HEAD
collaboration with Nicolas Malvé, wrote a manifesto for an active archive.
it's important for cultural institutions to think about software
it's a pity to give your/institution's ability to contextualising your files/media to platforms like Youtube

• Do (not) repeat yourself
essay entry, based on the following sentence/principle:
Every piece of knowledge must have a single, unambigious, authoritative representation within a system
totalitarian piece of language, contradictionly enough written inside a wiki

Riding a train: Ellen Ullman, close to the machine: technophilia and its discontent (San Fransisco: City Loght books, 1997) 21
against "programming/maths as 'cold' practises"
but .... process is very much about passion, changes, and also a lot about repeating and making mistakes

So the paradox: Programming is in fact a repetitive, tedious, and riting physical activity, one an in which repeption is an inherent part of the process. What appers to be a contradiction at the hear of free software is in fact a key aspect of its essence: [ ... ] ref missing.

mm: The tension between a single unambiguous type of knowledge, it's more about a drive, rather than about a final form

the fact that a wiki article is a conversation, with a history, showing the problems in the text. don't see a wiki article as an end form

• Software with an attitude
the first wiki (wiki wiki web?) had a warning sign that announced the 'attitude' of the software

• Video Wiki
interface/tool made in the context of active archives
it's a kind of browser, you connect a video within the interface by entering the url in the interface
interviews with citizens of Brussels
inspired by the design tools of a wiki, a smooth process from writing to reading
but a video is a heavy medium, heavy in size (GB's), heavy in using Final Cut (computer starts to breeze...)
So this project tries to use the principle of the wiki and apply this back and forth to a video process. Annotations and notes with a timecode to quickly mark up the video with tags, and 'layers' of annotations.
Chapters to a video, without calling them chapters. More like morcels. Fast tabbing, scrubbing through videos. Therefor removing the heavyness of the medium, with this tagged augmentation.

Backend/Frontend (simpler), and having the ability to copy a part of the video in an <iframe>, to place it on another website --> non centralized distribution

• Erkki Kurenniemi
Finish music engineer (Finish Steve Jobs? ... trrble description)
Documentary about him: https://vimeo.com/59974170 (by the way, the rest of the channel has interesting trailers)
making instruments for other people

Archiving the Data-body: human and nonhuman agency in the document of Kurenniemi.
serial (proud) archivist

The artist & engineer's body of work was subject for Documenta 13. At first no body would touch it, but still Constant & Co took on the task of parsing the TBs of (digital?) archives.
It became obvious that the data was not going to be able to be sorted as self. No easy categories or themes were apparent, so M & team had a look through the side info of the medias, IE the metadata.
Metadata as a sorting argument.

imagine a picture (Essay by Nicolas)
meta-questioning: what is a picture? what does it mean to put it online?
soon an essay about this process will be published in a book (about Kurenniemi?)

Not being able to understand the data was a good reason to opt for this meta sorting method.

logbook, to read the process: http://sicv.activearchives.org/logbook/

• CV: Computer Vandalism / computer vision)
invited Matthew Fuller for a talk

> speaking stones
relating the video of the presentation of Matthew back to the images in the images

"Computers are stupid, in the way that they do exactly what they are told"

what does it mean .... computer vision? that visual archives are being indexed? (by institutions like google) what does it mean that a lot of the national libraries use google as an index?
computation is something that actually needs critical engagement
in a much broader sense than just 'code that works'

--------------------------------------

Annet Dekker

http://aaaan.net = shared website
Annet + Annette Wolfsberger + Sandra Fauconnier

• Annet studied at the University of Utrecht
mix of gender studies + cultural studies, new media and technology
media psychology

thesis: Image Culture, how the Dutch marine designs their advertisements
after graduation: choosing to work with Marines, or in the advertisement world
but hard to find a job at the time, --> volunteering in art organisations (strategy that enables one to keep social benefits as if her/his status was = unemployed)

how youngsters deal with new media
event at Veronica, showing a wide range of organisations from the artworld
Stereotypes in detectives. Detectives being quite a phenomenon in TV culture at the time. But project ended up in the shelves.
Axis / Access? (?) - Gender Art Technology (can't find it)
This is the point of entry into the arts world. At least it is the point at which advertising became a regection for A. (Not necessary to agree with customers, moral aspects ethics, etc)

interest in art/works that have a technical background. How can you subvert things, question things.

• Impakt festival (Utrecht) http://impakt.nl/festival/
A was working as a volunteer for years
working at the reception desk + programming the festival, making exhibitions, projects --> then CD-ROMs as a collected media, along side websites.

• NIMk (Amsterdam) http://nimk.nl/eng/
(first called Montevideo, later it became the NIMk)
doesn't exist anymore
A became a curator then. Previous curator = very fine arts orientation, Annet wanted to push a media art direction
the NiMK was also a production house for video arts
in the 90's they grew to become a media art institute

the discovery that the rift between the named media art and video art was quite hard to cover.
media art was just entering the scene, was involved more with computations
video art was maybe closer to the art world

• A just worked on a show in the SMBA http://www.smba.nl/

• Are you experienced
exhibition that is created in an educational framework, rather than an artworld framework
Jan 2002

• how to document these works/projects?
video would be a good start to document works that are interactive
which became also a course here at the PZI, as Simon asked A 3 years ago

• Artists in Residence (at the NIMk)
Previous structure had a 'technical support' orientation which quickly became complex, so the rething was a focus on thematics over techniques.

collaborative artist in residence, which moved from place to place, in a network of different cultural organisations in Europe
Naked on Pluto being an example of this split / collaborative lab residency for artists. Ref to A. Mansoux

as A was making 5 exhibitions a year, and started to miss depth

• A did her PHD at Goldsmith in London
Decision to do it in London was a time factor. The Netherlands phd = 4 years (part time 8 years) whereas UK PHDs are 3 years (6years part time)
first A wanted to write about interactive arts in public space
supervised by Matthew Fuller

PHD topic shift away from the prev theme, towards a concern for maintenance of 'net art'
Video maintenance is a well defined field but for net art maintenance there is no solution/conclusion yet
net art is a process based working process

The thesis suggests that this maintenance needs to be considered in different ways. More focus on documentation, less focus on keeping the oeuvre alive.
one strand is authenticity for example, what does that mean in a digital age? Walter Benjamin spoke about it. We need to redefine it.

An other strand is: what is a document (meant very litteraly) physical documents, yes but digital documents, what are they, what is their status?
what really are those? can we talk about them in the same way? how does that effect our relation we have with them?
--> current topic of research

• currently collaboration with the Southbank Centre in London http://www.southbankcentre.co.uk/
Images as an example: comparing analog images to computed images. Research ongoing.

A became interested in archives, which not directly need to be related about conservation, a link that has been made quickly.

• Currently with Het Nieuwe Instituut: http://hetnieuweinstituut.nl/
Looking at digital archives. The future of digital archives. Mainly the future of the content inside the digitial archives.
A was asked to commision 5 projects related to the archive of the New Institute
event: a public lecture Richard Vijgen http://hetnieuweinstituut.nl/richard-vijgen-over-datavisualisatie

Template http://template01.info/

Marlon: research on Templates, standardisation
Lasse: disappearing about archives, Google Earth's sketch up scene
The creative promise and open collections

the New Institute publishes their archive on Flickr commons
how can these be (mis)used, curated?

made into packages, to sell them again in the bookshop of the New Institute
http://prettyold.pictures/

:)Algorythmic Ribbish : Saring to Defy Misfortune (funny that you place bullets manually • rather than using list items from the etherpad interface? :) ••••) :)
! ah (might be better, as this would output an <ul></<ul> if exported to HTML :), true.. it's just quicker to type then to click, funnely enough. )

Group exhibition at Stedelijk Museum Bureau Amsterdam
12 September - 8 November 2015
http://aaaan.net/algorithmic-rubbish-daring-to-defy-misfortune/
http://www.smba.nl/en/exhibitions/algorithmic-rubbish-daring-to-d/

ideo of open data, and showing the dark side of it, opposed to the great side of it
how you can turn them into your favor

SMBA asked A: why do we need to show these? if you can find them online?
- hard to find them online
- isn't exhibition making about creating meaning?

how to pin images onto the world?
- gold/white/black/...?
- SMBA crew normally gets a very precise discription how to show a work, but in this exhibition, the crew got a digital file without instructions
this is illustrating a difference between the artworld and a new media world ...

Tate in London

advising on software based artworks
- make up documentation files
A was given a list of process of video arts, which would be the most close to software based art
Example taken from the proceeding of management of video art, versus software art.
there is an addmittance of not really knowing how to deal with this, " that it's going to change in 5 years anyway, so why bother ".

book: Speculative ...

made in context of an event at the van Abbe Museum

*events*

- documentation at the Stedelijk Museum, Amsterdam
evening of talks + performance by Jody
http://www.stedelijk.nl/en/calendar/forum/79432
(The Homo Documentator - expanding documentation in the arts?)

- 26th oktober: how to do arts with networks?
at the Rietveld Academie in Amsterdam
presentations + workshops

---------

SR: reaccuring theme yesterday with Michael:
*archive as mode of production, or archive as mode of conservation*

A: archive as paper archive, with someone that knows all about it, + good stories
but more interested in databases, different forms

there are archive-studies in the universities, high profile studies
which is another approach then A's interest, which is another enter

SR: what is a document, what is the collection? how do we see an object as a document, or as part of a colleciton?
why do people worry so much about the pins? it's a certain economy. what does make an artpiece?

A: how can you preserve the discourse around media art? which is very different from art?
how do you preserve that, before it ends up on the shelves?

SR: archivist, collaborator, organizer
A: these go parralel, you can't seperate them

TW: larger organizations are more protective?
A: but understandable. Tate has a certain authority. So if you make a mistake, it will touch the whole organisation. so they are very careful with publishing.
currently writing an article, but it goes through different people within the institute, which slows down the project
SR: it's a system of verification
A: very hierarchial, and thus slower

SR: what about your website? is it stable?
A: some elements are not working as they did already

C: before it was the case that a contract would be signed which says that a website will work for 4 years, and only on IE8 and Firefox 20?
but now: a website has been made and then expected to be maintained by the owner

A: Visual litteracy
an overlap between an understanding how technology functions, and a visual approach
one needs to know how something works, in order to subvert it
maybe it's more about understanding, rather than doing it yourself

RV: what happened to the field of media institutions in the Netherlands?
A: difficult questions. a lot of the reasons are political, funding is pulled back.
there is not one reason. politics + networking + ...

A was working with SKOR http://monoskop.org/SKOR
40% of SKOR's income was not funding
but still their funding was cut

also part of funding commitee's
Constant Dullaert
Tech Dull
A pushed to see it in a different light
and so he got the funding

it's not so much that there is less interest in culture
but it has been seen as a hobby lately

SR: do you think there is a difference between current young new media students and the network-artists?
before there was internet needed, and people crewed up together
A: these collaborations still continue
but tools are more available
but i don't think it's so much different
there is a difference in aesthetics of course, but yes

-------------------------------------------------

Steve Rushton

life.live

a movie makes sense
all of us have been trying to make sense

Steve is making a story today

every+nhivng

everything magazine

a magazine set up by S

Kaplen - W.M.D (weapons of mass destruction)
Signal/Noise

everything magazine (1992-2001)

Life/live catalog for an exhibition - has a map of artists run projects in London 1996
Exhibition that tries to look at the political economy of this network

it would have been useful to make a website to connect a range of art organisations, but that was not where the artworld was interested in
Analog network with a discourse, before everyone had the Internet

Tried to talk to the peolple inside this network and especially tried to understand it.

artists like Damien Hirst + Tracey Emin revolutioning the artworld
> Young British Artists (generation freshly graduating from Goldsmiths at the time)

a model of flexible temporary spaces, particulary economy of scale, was a way young artists were organizing themselves, and so the magazine followed this model

the magazine as a comment
what is going to happen to London in the coming time?
big dome --> the Millenum Dome
big gallery --> Tate Modern
big art --> sculpture (The angel of the North, Anthony Gormley , 1998- near Liverpool)
big wheel --> the London Eye

*AD MAN YOU'RE A BAD MAN!*

Bank is a good example of a group that was making a critic of what was happening in London at the time.
They mimicked lots of institutional productions (bank tv, publications etc)
Mix of Young British Artist art and alient items brought in by Bank

Bank had a fake tabloid, Bank TV, Dogumentary
https://en.wikipedia.org/wiki/BANK_%28art_collective%29
http://www.thecentreofattention.org/dgbank.html

Acknowledgement that London could not have a proper view on its own medial roots.
the artworld then were very much depended on media

attempt to create a space for discourse, an experiment to make place/space
distribution was important, to print it, to be autonomous about the content, production investigation
Based in practicalities of Discourse.

«Everything ago Zine» (?) the penultimate issue

by now, it has run out of it's necessity (or it had accomplished it's goal)
S started to make books

The books were not so much about London anymore, but starting to look at the art world
in the form of writing stories

Everything online
- magazine (1996/1997)
- Library of Bable
- cramley (local authority that didn't exist)
- artist projects (commission agency for other projects)
--> EBC (netcast?)

attempt to let artist think about the media context they operate in
They played with the promise of convergence of art and media

means of engaging and discussion, initiating

Kaplen

George Kaplen, in North by North-West (Hitchcock) - a person that is mistaken for a fictional character invented by the CIA called Kaplen
people suspect them to be a spy, and so he starts to act like a spy

being 'undertheorized'

S went to the JVE academy (2001-2002)
http://archived.janvaneyck.nl/4_4_cv/cv_t_rus.html
http://archived.janvaneyck.nl/0_4_3_publications_info/rushton2.html

S started to collaborate with Rod Dickinson http://www.roddickinson.net/pages/index.php
how does an object comes to be?
crop circles, and their media attention
which lead to a production of writing news-articles, reports on them

crop-circle video:
real life is stranger than fiction
so, you're a believer?
this leads to a situation where sceptics have to make circle to proof how they are made
a lot of people forge £20 notes, but that doesn't mean that all £20 notes are fake

these people together are producing meaning around something that does not exist.
how are we going to talk about this 'nothing that is there'

the Milgram Re-enactment (book, created at JVE)

http://archived.janvaneyck.nl/0_4_3_publications_info/rushton.html
http://www.roddickinson.net/pages/milgram/project-synopsis.php

WMD (weapons of mass destruction)

the believe that these weapons were present in the Middle East

who, what, where, when, why and how (2009)
http://www.roddickinson.net/pages/whowhatwhere/project-synopsis.php

the first clip was dealing with the rhetorics of the justification of war
working with political speeches taken from the internet, from the contemporary radius

second clip is about crisis
something that is maybe needed for the current discourse of society

signal/noise (±2011)

Showroom http://theshowroom.org http://theshowroom.org/research.html?id=161
The Showroom is a space for contemporary art that is focused on a collaborative and process-driven approach to production, be that artwork, exhibitions, discussions, publications, knowledge and relationships.

how the idea of feedback is used in a cultural field

involved:
- Stuart Bailey had been the designer of Everything Magazine

(and so the magazine Dot Dot Dot is influenced by this http://www.dot-dot-dot.us/ )

- Casco (office for art, design and theory based in Utrecht) http://cascoprojects.org/

Dot Dot Dot #?
project: the first last newspaper
building opposite of the NYT building
http://www.dextersinister.org/index.html?id=238

article: how media master reality?
published in differen Dot Dot Dot's
which was a continuation of the Everyday Life magazine

S is currently working on a PHD
status: *a big void*

book: Masters of Reality
a collection of essays
http://www.worm.org/home/view/event/4744

------------

AD: you started to comment on discourse, and then you made renecatments of discourse
what is your next step?

SR: People like us and people like Bank had started working like this because before us there were artists with a political position and they did precisely this: produce a "critique" discourse, but that didn't change much (they got stuck in the economy of the discourse they had created, and that prevented them from being transformative). (Art & Language is an example)
in the magazine we established a form of writing, that was not about that types of reflection

we are unreliable witnesses, pointing back on undertheorized

historical account of the future: the main reason that art died.. they recognized they were making media art (?) (art died because it didn't understand media)---- it became aware of its own "media ontology and then couldn't deal with that"
art discourse is actually nervous about media

AD: if media in the future died, because they recognize to be actually media, do you say that media isn't art?
S: that was not the point. it was more a way of situating the issue

R: you act in an art discourse, is this the ideal field to talk about discourse
S: in London, the Saatchi gallery appeared, we reacted on the art discourse

art discourse and media discourse are divided
1995: Matthew Fuller in Mute: why these two camps can't go on?
this is a frustrating contradiction

but not everything i do is only concerned with the art world
not interested in subjectivity, but in how symbols are mediated

Ine Lamers

I'm an absolute beginner... RIP Bowie, 11Jan 2016
Part of the initial think tank behind the setup of PZI in 1995 (for which course was that? Not sure that was mentionned, and I don't know enough about the initial setup of the school!)

interested in methods, reflection ... in an artistic project

Admission of a weakness: weaving into detail

5 years spent at Rietveld as the head of photography department. She is happy to work with the medium directly again, and work together here.
Ine tries to follow philosophy courses in the universities beside her work.

artistic practise:

Ine works with photography & video
interested to let the medium be part of the work
a 'heterogenis' practise (?)
work based on personal stories & fiction
interested to look at architecture, how political systems are reflected in the structures, separations of private and public, and it's reflection in the simple structure
example used of the Brunswick (now a shopping mall) complex / socialist architecture in esat Berlin
Russia & Moldova also a subject matter for photographs within this structural reflection theme
Ine's work is in between documentary & fiction, specially her video work; although she doesn't believe in objective documentary --> 'subjective fact of the lens'

Work examples:
NOTSHE: about a woman - a film about a trip - lost in a film studio
ref to 'not I' Beckett

http://inelamers.nl

Femke Snelting

first: bio timeline
then: 3D software project

bio timeline

1997 - 2010 (?): de Geuzen (Amsterdam) http://www.geuzen.org
2000 - 2005 (?): setting up Piet Zwart with Matthew Fuller http://pzimediadesign.nl/
2003 - ... : Constant (Brussels), association of arts & media --> intersection of copyleft & free software & feminism

active archives --> http://activearchives.org
cqrrelations --> http://www.cqrrelations.constantvzw.org/1x0/
spreek u ..., a project about different languages in Brussels --> http://spreektu1060.be

2005 - 2011 (?): Samedies, group that gathered every 6 weeks by building their own server; to think about the concept of 'free software', that is aiming for a accessibility for every type of person. & as ... free software culture that is mainly crowded by 30y old white man; http://samedi.collectifs.net/
2006 - 2011: OSP, Open Source Publishing; an excercise to be a design studio working only with free software http://osp.kitchen/
Libre Graphics meetings http://libregraphicsmeeting.org/
2009 - ...: http://snelting.domainepublic.net/
2011 - 2013: Libre Graphic Research Unit http://lgru.net --> a project to reflect on the use of free software, reflection on the practises of OSP
2016: Mondoteque http://mondotheque.be

Make Human

workshop with Constant: Gender Blending: for a week a combination of people with different backgrounds worked together, interested in this piece of software http://constantvzw.org/site/-GenderBlending,190-.html
http://www.makehuman.org/
description MakeHuman project:

"photorealistics humanoid characters"
technology --- representation --- normativity
MakeHuman is free software, which is also an invitation to research & critique the software. this project is a meta-bug-report
looking at the software means also looking at the forum, file history, ...
"to pull apart this technological object"
"MakeHuman as thinking machine", something to think with, something to discuss with
"software is culture, software making is world making"
we don't have to accept software as it is, we can make it change
"full of assumptions of naturality & ..."
the people that work at MakeHuman, work themselves in positions of representation:

natural history museums
modelers for hollywood films
....

3d scanning & this type of software is used for plastic surgery modeling (a before & after prediction image)
"cause mirror effects & affects on both sides on the screen"
MakeHuman describes itself as middle-wear (in between the quantified self, and the graphic tricks of 3D hyper-realistic modelling)
stereotypes --> normallity is put to young white healthy and correct bodies
horizontal sliders

gender (not A or B, so... promising, but when looking in the code it shows that it's just A or B that is selected)
age
muscle (when gender is slided, the muscle slider moves)
weight
height
proportions
african
asian
caucasian

"the user gets the suggestion that every combination is possible" but there is a limitation encoded in the software
by renaming labels and changing them by questions (changing the interface, not so much the code already made a big difference)
(in software, there is always an desired construction, and a possible construction)
there is a strong differentation of inside and outside, which connects to the nature of 3D software
there is a warning for nudity when users start up the software
genitals can be added under the section 'accessories'
"the tricks of the natural and the horizontal"
we see the algorithms at work: creating a virtual reality ... untouchable presence
"the software as a thinking machine", "MakeHuman as maybe a possibility for something else", "the latent potential of working through software objects"
"in stead of looking like nature, could we think about living with technology? bodies defined through technology?"
"potentialities of software open up"

working on a meta-bug-report, that could function within the community of MakeHuman, to intervene with the workflow of the software developers

how software functions on a philosophical & cultural level.

http://www.makehumancommunity.org/sites/default/files/styles/medium/public/field/image/milkman_mirrormirror.png?itok=nMWIGVDo
Winner of the november monthly contest on makehumancommunity.org

(Thursday 3rd March 2016)

Marloes de Valk

"replacing Annet"
Sutied sound and image -- No rules
Human and computer interaction theme
Thesis about blocks world (??)
Computers as an anthopomorthic thing - a black box with stuff inside, made by humans.

MacLuhan on the way tools influence our work
Vino-graed author? (Manetta? please complete)

Interactivity as a magic trick. Installation confronting people with their expectencies of interaction.

Netherlands Institute of Media Art educationnal program development

V2 program manager

Digital research unit univeristy of Huddersfield, with Aymeric, then leading tiards the dev of PHD projects.
--M had her epiphany in the UK-- She will not do a PHD

pi.kuri.mu/pond/
antrhopomorphic 'vis' of network packages 'as DNA'
written in 'Forth' language from the 70s
Metabiosis umbrella project

This pad is so lonely!

pi.kuri.mu/hello-process/
next Itteration of the metabiosis project using dot matrix printers

---

Naked on Pluto project / privacy / facebook / text based game / Elastic Versailles Universe
'explorative' env showing twitter (like?) feeds
Vida prize

---

/skor-codex/
comission from SKOR platform (now dead -- funding cut) on their archive
An archive planned for 'the really long term'
book contains color photos and sound files -- outputted in binary

We try to use as little language as possible

Keith Griffiths — 2016_03_08

cooking = filmaking
timing, ingredients, choices, presentation, reaching an audience, all the key elements of making food are the key elements of film making

simple cultural image sharing —
The
Jan Svankmajer — Jaromir Kallista
Creative Group
present

https://en.wikipedia.org/wiki/Jan_%C5%A0vankmajer

Side ~~tech~~ note: the projector in the large project space has a big issue with color. As if green was not outputting or something.
So we change rooms, go to the sm project space, log in to the computer there, with the student account, then start the DVD.
Error message: this DVD is is set to zone 2, but the drive is set to zone 1. To change, please input admin password. FM/OL.

We're now watching the DVD on Pleun's Laptop.

Radio On http://www.imdb.com/title/tt0079773/?ref_=fn_al_tt_1

https://en.wikipedia.org/wiki/Apichatpong_Weerasethakul

Uncle Boonmee

Thomson & Craighead — 09_05_2016

http://thomson-craighead.net/

http://www.whitechapelgallery.org/exhibitions/electronicsuperhighway/

songs of innocence and experience

kareoke video with spam as text basis, stock photography as backdrops, installed as a singer performer environment.

A short film about war

2 / 3 part film (partly shown in Witte de With in Sept 2015) in collab with Steve Rushton

Horizon

Collation of world wide webcam feeds, 'comic strip' rendering.
Collects GMT feeds from -12 to +12, continously updates itself.
Graceful decay, the work plans for some of the webcam feeds to go down, and accomodates space for this to happen, gracefully.

A temporary index

part of the Nuclear Culture research group, project = 5 / 6 years going,
T & C are now artists specialising in nucelar waste storage
Nuclear semiotics, the act of thinking about the waste management, for periods of 10 thousand, 100 thousand, years.

Stutter

Work that looks t obuild a monument to the first human genome
CGGCGAGGCGCAGAGACACATG
Breaking down this huge human accomplishment into 4 simple letters, then re-extrapolated and projected onto the complexity of the human culture.
The letters trigger words. Spoken words extracted from tv segments.
Naom Chomski: our ability to communicate is what made the humans survive.

(perfume) the book of revelations Apocalypse

getting a perfume artist to perform their interpretation instead of a computer
perfumier Uan Mc(?)
Chemical depiction of the apocalypse
The progressions of the smells over the period of time that you would wear the perfume become very narrative.
Apparently starting with incents, and smoke, then later tonics, then sweet putification.